Amphetamines anticonvulsant drugs and selective serotonin inhibitors treat

Answers

Answer 1

Answer:

I don't know how to do it the question

Answer 2

Answer:

behavioral issues.

Explanation:

<3


Related Questions

how to thelimonsaltguy

Answers

Answer:

CONFIDENCE

Explanation:

Gina is a friend of Nicole's. What advice should Gina give Nicole? Check all that apply.

“You can still contract STDs even if you’re not engaging in sexual intercourse.”
“Is this something you’ve discussed with Anthony and are ready to do?”
“Anthony won’t respect you if you don’t eventually have sex with him.”
“If you think it’s a good idea, go for it.”
“Being abstinent means avoiding all sexual activities, not just sex.”

Answers

Answer:

-"You can still contract STDs even if you're not engaging in sexual intercourse."

-"Is this something you've discussed with Anthony and are ready to do?"

-"Being abstinent means avoiding all sexual activities, not just sex."

Explanation:

Answer:

A B E

Explanation:

got it right on edge

HELPPPPP ITSS TIMED
Zoe is a nursing assistant doing oral care for three patients. The chart describes the oral care that was performed on each of the three patients.

Procedure for Oral Care for Three Patients

A 2-column table with 3 rows. Column 1 has entries Marta, Michael, George. Column 2 is labeled Procedure with entries Zoe introduced herself, helped the patient into an upright position, properly brushed the patient's teeth, and used mouthwash; Zoe moved Michael onto his side, used a padded tongue blade, and used a cleaning agent on his teeth; Zoe performed hand hygiene, gently flossed between the patient's teeth, and prevented aspiration.

Which best represents the patients?
Marta is conscious, and Michael and George are unconscious.
Marta and George are conscious, and Michael is unconscious.
Marta is unconscious, and Michael and George are conscious.
Marta and Michael are unconscious, and George is conscious.

Answers

Answer: A. Marta is conscious, and Michael and George are unconscious.

Explanation:

If they are trying to prevent aspiration, the patient is likely to be unconscious and needs to be turned on its side. This prevents the patient from choking because if they’re unconscious, they can’t swallow the saliva.

Simplify. secxcotx. ALEKS

Answers

Explanation:

the rule cot(x)=cos(x)/sin(x)

and sec(x)=1/cos(x)

[tex]cot(x)sec(x)=(\frac{cos(x)}{sin(x)} )(\frac{1}{cos(x)} )[/tex]

the cos(x) cancell and you are left with 1/sin(x)

Hope that helps :)

Marathon runners:
A. are always very thin.
B. only eat carbohydrates.
C. tend to have more slow-twitch muscle fibers,
D. can run only one or two marathons a year.

Answers

Answer:

c

Explanation:

marathon runners tend to have more slow-twitch muscle fibers, while sprinters will have more fast-twitch muscle fibers which allow faster movment but does not last as long while marathon runners have more paced and can last a long time.

Answer:

C.tend to have more slow twitch-muscle fibers

Explanation:

muscle fibers are focused on smaller movements, posture control, and fatigue resistance all of witch contribute to marathon runners.

Let's Check In

Vestibular information travels to all of the following areas of the brain EXCEPT the ______.

A. medulla
B. pons
C. prefrontal cortex
D. cerebellum

Answers

Answer:

C. Prefrontal Cortex

Explanation:

I calculated it logically

Answer:

C) prefrontal cortex

Explanation:

edge 2023

What nutrients are needed to make red blood cells

Answers

Foods rich in iron help you maintain healthy red blood cells. Vitamins are also needed to build healthy red blood cells. These include vitamins B-2, B-12, and B-3, found in foods such as eggs, whole grains, and bananas. Red meats , and organ meat are high in nutrition which will increase the amount of red blood cells in your body.

Foods rich in iron help you maintain healthy red blood cells. Vitamins are also needed to build healthy red blood cells. These include vitamins B-2, B-12, and B-3, found in foods such as eggs, whole grains, and bananas.

What are in nutrients?

Nutrients supply nourishment. Proteins, carbohydrates, fat, vitamins, minerals, fiber, and water, If someone do not contain the proper  nutrients in their diet, their risk of growing certain health conditions increases.

Thus, Red meats , and organ meat are high in nutrition which will increase the amount of red blood cells in your body.

To learn more about nutrients click here:

https://brainly.com/question/1268939

#SPJ2

Factor contributing to state of excess carbohydrates

Answers

Answer:

What does an excess of carbohydrates cause?

Excess carbohydrate intake places a large metabolic load on the body. When the body constantly has high levels of blood sugars (the end point of food sugar and starch) to deal with over time, this leads to weight gain, poor metabolic health and an increased risk of heart disease.

Explanation:

evaluate three ways in which employment will minimize emotional stressful​

Answers

Explanation:

people don't worry about running out of money, they will have money to pay bills

it is said that people who don't have a job tend to be more depressed, job will help them be distracted

coworkers can make you happy, so it can be a source of positiveness

Employment helps to alleviate emotional stress in the following ways:

Employment offers a means of income, Employment offers opportunity to meet new friends and Employment presents a good distraction from emotional stress.

What is emotional stress?

The term emotional stress refers to a situation in which a particular individual is overwhelmed by feeling of psychological strain possibly due to a past experience.

Employment helps individuals to overcome emotional stress in the following ways:

Having a means of income gives people some self confidenceThe work environment offer the person an opportunity to make new friends.Focus on work is a good distraction from the thoughts that lead to emotional stress.

Hence, we can conclude that employment is a very good way to overcome emotional stress.

Learn more about emotional stress: https://brainly.com/question/672130

Name the common glands/parts of the endocrine system:

Answers

adrenal cortex and adrenal medulla

What level of organization is represented by this figure?

subsystem

cellular level

body system

organ

Answers

Answer:

organ

Explanation:

organs are a part of the body system

Myasthenia gravis is a
A. form of cancer.
B. disease that causes heart weakness.
C. disease that affects about 90 percent of people in the world.
D. rare disease causing muscular deterioration.

Answers

Answer:

D. rare disease causing muscular deterioration

The patient tells the nurse "I'm so glad you are here. Those night
came around to check on me." The nurse's responds by saying "W
were extremely busy; otherwise, they would have been in more."
represents what type of barrier to communication?

Answers

Answer:

professional

Explanation:

what are the three steps of the standard collision-prevention formula

Answers

Three steps of the standard collision-prevention formula are to recognize the danger, understand the defense, don't panic, and act accordingly.

What is the standard collision-prevention formula?

DDC offers a three-step approach to preventing collisions: Identify the danger. Recognize the defense. Act appropriately and promptly.

The vehicle's speed at the time of impact can be determined by three indicators. The first is the area's posted speed limit. Second, any signs that the car was slowed down before the collision, such as skid marks or other signs. Lastly, consider how the car appeared following the collision.

In order to lower the possibility of an accident involving two or more skiers or riders, collision safety promotes on-hill safety and responsible skiing and riding. The #RideAnotherDay campaign was born out of the tragedy of an on-snow collision.

Learn more about the standard collision-prevention formula, here:

https://brainly.com/question/29544750

#SPJ6

PROJECT: EFFECTIVE ORAL READING
A good way to sharpen your speaking skills is to read an experienced speaker's work aloud.

Here is your goal for this assignment:

Read an oratory passage aloud


The following portion of a speech is by Daniel Webster, who was imagining that he was John Adams arguing for the Declaration of Independence. As you read, imagine that you are that great orator. Practice putting power, impressiveness, and deliberation into the reading. Try to use effective pauses.

When you feel that you can express it well, have your teacher listen to your reading, and comment about your voice quality.

Sink or swim, live or die, survive or perish, I give my hand and my heart to this vote. It is true, indeed, that in the beginning we aimed not at independence. But there is a divinity which shapes our ends. The injustice of England has driven us to arms; and blinded to her own interest for our good, she has obstinately persisted till independence is now within our grasp. We have but to reach forth to it, and it is ours. Why, then, should we defer the Declaration? Is any man so weak as now to hope for a reconciliation with England which shall leave either safety to the country and its liberties, or safety to his own life and his own honor? Are you not, sir, who sit in that chair; is not he, our venerable colleague, near you; are you not both already the proscribed objects of punishment and of vengeance? Cut off from all hope of royal clemency, what are, what can you be, while the power of England remains, but outlaws? If we postpone independence, do we mean to carry on, or to give up the war? Do we mean to submit to the measures of Parliament, Boston Port bill, and all? Do we mean to submit, and consent that we ourselves shall be ground to powder and our country and its rights trodden down in the dust? I know we do not mean to submit. We never shall submit. Do we intend to violate that most solemn obligation ever entered into by men, that plighting, before God, of our sacred honor to Washington, when, putting him forth to incur the dangers of war, as well as the political hazards of the times, we promised to adhere to him in every extremity with our fortunes and our lives? I know there is not a man here who would not rather see a general conflagration sweep over the land, or an earthquake sink it, than one jot or tittle of that plighted faith fall to the ground. For myself, having twelve months ago, in this place, moved you that George Washington be appointed commander of the forces raised, or to be raised, for defense of American liberty, may my right hand forget her cunning, and my tongue cleave to the roof of my mouth, if I hesitate or waver in the support I give him.

Answers

Answer:

There was conflict over the holy land of Jerusalem between the 3 major religions.

Explanation:

5-8 sentences

Which is the right relationship of calories and physical activity according to the Dietary Guidelines For Americans?

- eating fewer calories balances more activity
- eating more calories balances more activity
-eating more calories balances less activity
-eating fewer calories balances no activity

Answers

ANSWER-eating more calories balances more activity.

Which of the following is reusable after it receives the proper care?
A. Surgical scalpel
B. Surgical gown
C. Cast material
D. Medical gloves

Answers

the answer is: A. Surgical scalpel

Which of the following statements about developing a personal fitness program is NOT true?
A.
When developing a personal fitness program, it is important to implement strategies that will help maintain the program as well as give it a successful start.
B.
Personal factors such as age, health concerns, and likes are important to consider when developing a personal fitness program.
C.
The starting skill level of the physical activities included in a personal fitness program should be determined from other individuals' fitness programs.
D.
The FITT principle should be used when developing a personal fitness program.

Answers

Answer:D  

Explanation:

Genital herpes can be cured with the appropriate drugs

Answers

False ^ ^尿ありますか:))))))

Regarding the pathologies of the prostate, which one of the following statements is not correct?
a) Chronic bacterial prostatitis is usually associated with recurrent urinary tract infections. b) Benign prostatic hyperplasia results from proliferation of strornal and glandular elements. e) High grade prostatic intraepithelial neoplasia is the precursor lesion of carcinoma of the
prostate.
d) Most prostate cancers are squamous cell carcinomas. e) Most prostate cancers arise in the peripheral zone.

Answers

Answer:

d) Most prostate cancers are squamous cell carcinomas.

Explanation:

Most prostate cancers are adenocarcinomas, which is a type of cancer that initiates in mucus-secreting glandular cells. In prostate cancer, semen-secreting cells usually mutate into cancer cells. On the other hand, squamous cell carcinoma is a type of cancer that develops in the squamous cells that form the middle and outer layers of the skin. Chronic bacterial prostatitis is related to recurrent infections of the prostate caused by particular bacterial strains. Benign prostatic hyperplasia is a common condition in old men, which is characterized by overgrowth of the transitional and periurethral area. High-grade prostatic intraepithelial neoplasia is the main precursor lesion to prostate carcinoma, which results from the proliferation of prostate glandular epithelial cells. Finally, most prostate cancers begin in the peripheral zone, i.e., the outer area of the prostate next to the rectum.

Marijuana contains
compounds that are psychoactive.

A.61 or some
B. Less than 50
C. 79 known
D. At most 15

Answers

Answer:

ummm D im not a pot head

Explanation:

•Ddddddddddddddddddddd

Maria is pregnant. During a visit to the doctor, she receives a list of potential concerns and an emergency number to call if she develops any signs or symptoms that could indicate a pregnancy complication.

Which abnormal signs or symptoms might be on the list Maria received? Check all that apply.

insomnia
bleeding
fever
contractions
stretch marks
nausea

Answers

Answer:

bleeding because can indicate a miscarriage.

Answer: Bleeding, Contractions, and fever

Explanation:

hope this helps

(Edge)

Assimilate weather small or large intestine are better equipped for nutrients absorption

Answers

A few substances are absorbed in the stomach and large intestine. For example, water is absorbed in both of these organs, and some minerals and vitamins are also absorbed in the large intestine. However, about 95 percent of nutrient molecules are absorbed in the small intestine

Mental fortitude is necessary to be successful. *
True
O False

Answers

true (20 characters long)


Pls help, I mark u brainlist if is right!!

On an interdisciplinary team, the decision making___

a. is done by the core medical personnel

b.occurs only when the patient is discharged

c. takes into account the views and information
gathered from all involved

d. is the responsibility of the doctor in charge

Answers

Answer: C

Explanation: Decision making in an interdisciplinary team occurs at the interface between groups with varied backgrounds, orientations, interests, and goals.

CREDIT: pubmed

Describe how the following factors might affect a person relearning of speech and mobility regarding her age.

Answers

Age: 55 Mrs. Gregg's age may affect her speech and mobility relearning. As per case study, Mrs. Gregg's age at 75 can impact the recovery process.

b. Personality: Gregg's traits can impact her speech and mobility relearning. Traits like motivation, determination, and resilience aid progress.

What is mobility

As people age, learning certain skills becomes harder due to declining cognitive and physical abilities. Brain plasticity decreases with age. Reduced plasticity may affect Mrs.'s speed and extent. Gregg's progress in speech and mobility. Older individuals may have health issues that complicate recovery.

Mrs. Gregg's high motivation and determination to regain speech and mobility increases her engagement in therapy, enhancing her relearning process.  Gregg's relearning can affect speech and mobility recovery.

Learn more about mobility from

https://brainly.com/question/12346513

#SPJ1

Using all of the above information, describe how the following factors might affect Mrs. Gregg's relearning of speech and mobility. Use case study information to help answer questions. (3 marks) a. Age b. Individual characteristics: personality C. Environment 5.

=
Health, Fitn...
5. Physiological (1 point)
The processes and functions of the
body
The processes of the mind
Social needs, social behaviors, and
social problems
Otraits that increase the possibility of
developing an illness or disease

Answers

Physiological factors refer to the processes and functions of the body that contribute to an individual's overall health and well-being. These factors encompass various aspects, including biological processes, genetic predispositions, and physical health indicators. Understanding physiological factors is crucial for assessing an individual's health status, identifying potential risks or vulnerabilities, and designing appropriate interventions or treatments.

Physiological factors encompass a wide range of elements, such as organ systems, cellular processes, hormones, metabolism, and neurological functions. These factors influence the body's ability to regulate bodily functions, maintain homeostasis, and respond to internal and external stimuli. For example, factors like blood pressure, heart rate, immune system functioning, and hormonal balance are all part of the physiological aspects of health.

Furthermore, physiological factors can influence mental health and cognitive functioning. The brain, as a physiological organ, plays a central role in the processes of the mind. Neurotransmitters, neural connections, and brain structures impact cognitive processes, emotions, and behaviors. Imbalances or dysfunctions in the physiological aspects of the brain can contribute to mental health disorders, cognitive impairments, or behavioral abnormalities.

Additionally, physiological factors interact with social and environmental factors to shape health outcomes. For instance, certain physiological traits or conditions may increase the likelihood of developing an illness or disease. Genetic predispositions, family history of certain conditions, or lifestyle factors such as smoking or poor nutrition can all contribute to physiological vulnerabilities. Understanding these factors can help in preventive healthcare strategies and early detection of diseases.

In conclusion, physiological factors encompass the processes and functions of the body that influence overall health and well-being. They encompass biological, genetic, and physical aspects that contribute to an individual's health status. Physiological factors also interact with mental and social factors to shape health outcomes and can increase the possibility of developing illnesses or diseases. Recognizing and understanding these physiological factors are essential for promoting and maintaining optimal health and addressing potential health risks.

for more question onhealth

https://brainly.com/question/5496881

#SPJ8

which 3 populations do not have health insurance coverage, even after the implementation of the ACA? (a)younger, healthier individuals who do not have disabilities and choose not to purchase coverage(b) tribal citizens (c) undocumented immigrants (d) non-exempt individuals under the ACA (e) people who do not file income taxes and do not qualify for Medicaid

Answers

A, B and C.


After the implementation of the Affordable Care Act, known as Obamacare, many more people have access to health insurance. However, the ACA did not expand coverage to certain populations who may not qualify for Medicaid due to their immigration status or tribal membership.


The three populations that do not have health insurance coverage even after the implementation of the ACA are: (a) younger, healthier individuals who do not have disabilities and choose not to purchase coverage, (b) tribal citizens, and (c) undocumented immigrants.
Final answer:

Under the ACA, younger healthy individuals who opt out of coverage, undocumented immigrants, and people who do not file taxes nor qualify for Medicaid still lack health insurance coverage.

Explanation:

After the implementation of the Affordable Care Act (ACA), there are still some populations who do not have health insurance coverage. These subgroups include: (a) younger, healthier individuals who do not have disabilities and choose not to purchase coverage; (c) undocumented immigrants who, due to their immigration status, are not eligible for ACA coverage; and (e) people who do not file income taxes and do not qualify for Medicaid.

While the ACA greatly increased the number of insured Americans, these three groups often remain uninsured for a variety of reasons, including financial constraints, ineligibility, or personal choice.

Learn more about Health Insurance Coverage here:

https://brainly.com/question/36603882

#SPJ2

water------- when it is boil evaorapte​

Answers

Answer:

Water evaporates when it is boiled

Explanation:

Boiling-hot water will evaporate quickly as steam. Evaporation is the opposite of condensation, the process of water vapor turning into liquid water. Boiling water evaporates into thin air.

A hunter 1.6m tall, views a bird on top of a tree at anangle of 45°. If the distance between the hunter and thetree is 10.4 m, find the height of the tree​

Answers

Answer:

The height of the tree is 12 m

Explanation:

Please check the image uploaded for diagram and solution.

Other Questions
Plz answer quickly will you brainlist why did weimar Republic collapse Find the value of x. 2 3 6 Match the value chain activity in the left column with the scenario in the right column.Value Chain ActivityScenario1.Service activities2.Inbound logistics3.Marketing and sales activities4.Firm Infrastructure5.Human resource management6.Technology7.Procurement8.Outbound logistics9.OperationsChoose from:Assembly line, Buying (sourcing) raw materials, CEO and CFO, Delivery to the firm's customer, New-product development, Receiving dock and raw materials, Surveys for prospect customers, Warranty work, Worker recruitment Describe how the Spanish-American War was started? In 2020 Klusic LLC purchased and placed into service two assets, furniture (7-year property) on April 24 with a basis of $11,000 and computer equipment (5-year property) on November 18 with a basis of $15,000. Calculate the maximum depreciation expense for 2021, (ignoring 179 and bonus depreciation).) (Round final answer to the nearest whole number.) a. $2,714. b. $7,494.c. $4,572 d. $8,282.e. None of the choices are correct. Suppose that the willingness to pay of several fans for Ducks football tickets is shown in the table below.Poppy likes to eat hot peppers. A coworker brought Poppy a jar of extremely hot ghost peppers. The accompanying graph illustrates Poppy's total utility for these peppers.Use the graph to answer the question and assume that Poppy seeks to maximize her utility. Write chemical equations for the following reactions. Classify each reaction into as many categories as possible: 15) Water and dinitrogen pentoxide gas react to produce aqueous hydrogen nitrate.Write chemical equations for the following decomposition reactions. 18) Aluminum oxide (s) decomposes when electricity passes through it.Predict whether the following single-replacement reactions will occur. If a reaction occurs, write a balanced equation for the reaction. 21) K(s)+ZnCl_2(aq)->, 24)Al(s)+Pb(NO_3)_2(aq)-> (symbol _ represent a subnumber).Write the balanced chemical equations for the following double-replacement reactions. 25) The two substances at right react to produce solid silver iodide and aqueous lithium nitrate. A treaty that can be signed between two or more countries to lower tariffs and improve the import and export of goods is a free trade.a. Trueb. False Ali will repair his car tomorrow (change into causative)?What is the answer? Population density is a measurement of population per unit area or unit volume.A TrueB False Given the following sense strand of DNA sequence, transcribe it into mRNA, showing the orientation of the mRNA [i.e. 3' and 5' ends]. Then translate this sequence into protein [indicating amino and carboxy termini, be sure to check for an open reading frame as well.]5' GGGATCGATGCCCCTTAAAGAGTTTACATATTGCTGGAGGCGTTAACCCCGGA 3 Alfred Kinsey argues that human sexuality a. can be studied scientifically, by collecting a broad range of data about what humans actually do sexually. b. is a moral matter and therefore is not an appropriate matter for scientific investigation. If investor's revise their expectations and now expect that Canada's inflation rate will increase over the next ten years, what impact will this have on the slope of the yield curve? Briefly explain #I X Haba una vez una princesa muy hermosa. Pero un da una bruja muy mala le puso una maldicin. Su padre el rey empez a buscarla en la noche y el da. Poco saban que ella estaba en un castillo muy lejos. Un da un chico precioso paso por el castillo. La princesa lo sigui mientras el chico se iba a su casa. Todos los das ellos hablaran mucho hasta que un da se enamoraron y vivieron feliz para siempre. Can someone help fix this my teacher said its missing accents and that theres a better word for spell or curse. The scatter plot below shows the change in the demand for a pair of jeans at a store as the price changes. The sales manager uses y= -1.75x+92.13 as a line of best fit.What is the residual value when the price of jeans is $28.00?A)9.37B)1.13 C)1.13D)9.37 A researcher was interested in seeing if cats or dogs are more playful with their owners overall. The null hypothesis of this study isa. dogs will play with their owners more than catsb. cats will play with their owners more than dogsc. cats and dogs play with their owners at the same rated. more information is needed why could one argue that the typical word superiority effect findings are counter intuitive We do solemnly and mutually in the presence of God, and one of another, covenant and combine ourselves together into a civil body politic, for our better ordering and preservation. Which of the following is a true statement about the quote? This is a quote from the Mayflower Compact and reflects the principle of self-government. This is a quote from the Magna Carta and reflects the principle of limited monarchy. This is a quote from Common Sense and explains why the American colonists should declare independence. This is a quote from the English Bill of Rights and describes the basic rights of all citizens. PLEASE HELP! IM LIKE STUCK AND I NEED HELP! YOU'LL GET 50 POINTS !!!!