The legislative branch is made up of the House and the Senate, generally known as the Congress. In addition, the legislative branch has the power to create all laws, declare war, control interstate and international trade, and determine the most important taxes and expenditures.
What is the most important responsibility of the legislative branch?One of the three equal branches of government, Congress is granted a variety of significant powers by the Constitution. Congress, which has total legislative authority, is the only arm of government with the power to pass new laws or alter ones that already exist.
Many factors make legislative power important. The first is that it creates the legislation that governs the nation. The second is that it is responsible for oversight by the government. The third is the power to declare war that it possesses.
To know more about legislative branch, refer:
https://brainly.com/question/13732589
#SPJ4
Which of the following is a belief held by the theory of natural law?
Which question would best be answered by studying an area’s social structure?
A.
Why are crime rates higher in that area than another area?
B.
Why are most crimes committed by men?
C.
Why do crime rates rise during the hottest part of the summer?
D.
What type of personality is more likely to commit a crime?
Answer:
I think it's option (A) Why are crime rates higher in that area than another area?
Answer:
a
Explanation:
What is another word for mutual aid?
International logistic support is another word for mutual aid.
This is a benefit when regular people band together to fulfill one another's needs with the knowledge that our current systems are failing to do so and that we can supply those needs collectively, right now, without having to exert any pressure on established institutions to act morally. Some alternative terms for mutual help include international logistic support, logistic support, and logistic assistance.
Mutual aid is a concept and a method founded on the values of solidarity, direct action, cooperation, and understanding. Mutual help is not charity; instead, it is the creation and maintenance of new social networks where individuals contribute what they can and receive what they require, free from oppressive systems of authority.
To learn more about mutual aid, click at:
https://brainly.com/question/29641092
#SPJ4
What is a permanent feature if a representative form of government?
Answer:
Elections
Explanation:
I would guess that elections are what make a representative form of government actually representative. Without elections, the ones in power would not actually represent the views of the people.
“A law may be unjust and contrary to some principles of Government but parliament is not controlled in its discretion and where it err, it’s error can only be corrected by itself” Erskine may. Discuss
Other Commonwealth nations and territories received independence as a result of the Second World War. In Erskine May, a more detailed explanation of this procedure is provided.
What is the nation?Although the phrases nation, state, and country are sometimes used interchangeably, there is a distinction between them. A state is a self-governing political entity (notice the capital "S"). Country and State are both interchangeable terms. However, a nation is a closely-knit community of people who share a culture.
The European Communities Act, which recognized the right of European institutions to enact decisions that had legal effects in the United Kingdom, was approved in 1972. Later, Section 18 of the European Union Act 2011 clarified that UK recognition of EU law was contingent upon UK legislation nation.
Therefore, The Second World War led to the nations of further Commonwealth countries and territories.
Learn more about the nation here:
https://brainly.com/question/27126152
#SPJ1
John sold a pair of skis to Bob, making no specific warranties or promises of any kind other than letting Bob examine and try them. In fact, John did not own the skis; he had only rented them. When the true owner claimed them, Bob demanded his money back. John defended his actions by stating that he had made no warranty of any kind.
_____ holds that the Supreme Court should overturn the elected branches of government reluctantly and as a last resort.
A) Judicial reproach
B) Judicial restraint
C) Judicial activism
D) Stare decisis
Option (b), according to the principle of judicial restraint, the Supreme Court should only ever overthrow the elected branches of government if all other options have failed.
What does the Supreme Court mean by judicial restraint?Judicial restraint is the refusal to use the judicial review process out of respect for the normal political process. Judicial restraint is the political theory that says courts shouldn't, unless absolutely required, issue rulings that broaden or alter the scope of current laws.
A philosophy of judicial interpretation called "judicial restraint" urges judges to limit the use of their own authority. It states that judges should refrain from overturning legislation unless they are blatantly unconstitutional, albeit the definition of what constitutes blatantly unconstitutional is open to considerable discussion.
The stare decisis principle, which states that new decisions should be consistent with earlier ones, a conservative view of standing, a reluctance to grant certiorari, a tendency to issue verdicts that are specifically tailored to the case at hand, and avoiding "unnecessary resolution of broad questions" are all examples of judicial restraint.
Learn more about judicial restraint: https://brainly.com/question/14276997
#SPJ4
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT
Answer:
The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.
What are 3 purpose of taxation?
The purpose of taxation include: Generate public revenues that enable us to fund investments in human capital, infrastructure, and service delivery to citizens and businesses.
What are the characteristics of taxes?Characteristics of the effective tax system: 1) Fairness or justice means that everyone should pay their fair share of taxes. 2) Adequacy means that the tax must provide sufficient income to meet the basic needs of society. 3) Simplicity means taxpayers can avoid the maze of taxes, forms, and filing requirements.
What are direct taxes?A direct tax is a tax that a person or organization pays directly to the taxing entity by one taxpayer. Direct taxes include: Personal income tax. Corporate tax. Capital gains tax. Inheritance tax. Property tax.
What are the three basic types of taxes?All taxes can be divided into three basic types: 1)Taxes on things you buy 2) taxes on things you earn 3) taxes on things you own.
To learn more about tax visit:
https://brainly.com/question/3211815
#SPJ4
In a violent culture, the level of “background violence” is _____.
Group of answer choices
Answer: Violent culture is associated with social disputes.
Explanation:
In a violence culture the background violence includes the reason for violence. It can be because of lack of literacy, stress, financial crisis, family and neighborhood dispute, domestic dispute, jealousy, criminal conduct, argument, racial discrimination, abuse of powers, alcoholic aggressive behavior and disputes, social injustice, gender discrimination, and other reasons. These reasons promotes the violent culture.
Who can create PACs?
Answer:
Members of Congress and other political leaders often establish nonconnected committees, usually called leadership PACs. Leadership PACs usually support candidates for various federal or nonfederal offices.
Explanation:
what is the example of red lie?
red lie are lies to harm others
Explanation:
example:
Danice: Mr William Jake took your phone and smashed it on the ground
Mr William: What?
* Then Mr William argued with Jake and scolded him so therefore Danice told a red lie*
Hope it helps
A claim made with full knowledge that the opposing person already knows it to be untrue.
What is a red lie?Red lies are just about retaliation and spite. The desire to hurt others, regardless at the cost of one's own harm, drives them. "A brilliant red lie" refers to a complete fabrication or something wholly at variance with the truth. The phrase "a red stranger" is another way we describe an individual who is a complete stranger.
An example of a red lie will is:
Even though you detest the meatloaf, you proclaim to your mother that it is excellent. You do not wish to tell her buddy that she's gained a significant amount of weight and appears heavy, so you respond as she asks saying he doesn't look big in her dress. In this, there is a red lie that is presented.
Learn more about red lie, here:
https://brainly.com/question/25427223
#SPJ2
What are some examples of mutual aid institutions?
Some examples of the mutual aid institutions are the Unions that are formed during the emergency situations.
Mutual aid institutions are the institutions which are formed to tackle the emergency situation that occur in any country or state. The emergency situation may arise from any man made hazard or natural hazard. Man made hazards include fire, chemical leakages, etc. while natural hazards include floods, earthquakes, etc. The governments of different countries form unions which help the people who suffer from these hazards and these unions help people of different as well as same country in the time of any emergency situation. Some other mutual aid institutions include Societies, social groups and Guilds.
Learn more about Mutual aid at:
brainly.com/question/29641093
#SPJ4
What did Roosevelt believe was the purpose of government?
Candidates for the U.S. House of Representatives must be at least 25 years old, and candidates for the U.S. Senate must be at least how old? Select one: O A. 25 O B. 21 Ос. 30 O D.35
Answer:
It is C.30 years old
Explanation:
Do US appellate courts have original jurisdiction?
Courts of Appeal have appellate authority in a few other situations that are outlined by statute as well as when superior courts have original jurisdiction.
What Does the U.S. Court of Appeals have original jurisdiction?Courts of Appeal have appellate authority in a few other situations that are outlined by statute as well as when superior courts have original jurisdiction. In habeas corpus, mandamus, certiorari, and prohibition actions, they have original jurisdiction, just like the Supreme Court (Cal. Const., art. VI, 10).A three-judge panel decides each case. If a panel's decision meets specific publishing requirements, the panel's "opinions" are published in the California Appellate Reports. According to the California Constitution's Article VI, Section 14, and Rule 8.1105(c) of the California Rules of Court, an opinion is generally published when it creates a new legal principle, addresses a legal matter of ongoing public interest, critiques an existing legal principle, or significantly advances legal scholarship.To Learn more About original jurisdiction refer to:
https://brainly.com/question/342388
#SPJ4
Who uses the PACS system?
While radiologists have predominately used PACS -- radiology traditionally being the most prolific producer of X-ray snap shots -- PACS applied sciences have been integrated into different departments, such as nuclear medicine imaging, cardiology, pathology, oncology and dermatology.
How is a PACS used in a radiology?In scientific imaging, electronic picture archiving and communication systems (PACS) have been developed in an strive to provide comparatively cheap storage, speedy retrieval of images, get right of entry to to photos obtained with a couple of modalities, and simultaneous get entry to at multiple sites.
What are the blessings of PACS for patients?The satisfactory advantage of the PACS device is that it gives effortless and speedy get right of entry to to patient pictures and reports. It approves checks to be performed without difficulty and anywhere, while the effects can be shared to other services electronically as well.
Learn more about use of PACS system here:
https://brainly.com/question/6908011#SPJ4What is the first step to reducing risk in the highway transportation system?
A. The first step is to understand what are the risks.
B. The first step is to understand what traffic signs mean.
C. The first step is to understand when to brake.
What branch of government controls the National Guard?
The US Department of Defense (DoD) collaborates on the Regular Army, which is made up of reserve elements of the US Army and the Air Force.
Why would you use the Federal Troops?
A distinctive component of the American military that serves both the neighborhood and the nation is the National Guard. The Guard reacts to domestic crises, military operations abroad, anti-drug campaigns, reconstruction projects, and more.
Does the National Guard pay you?
Every day that you serve, whether it be during training, weekend exercises, annual training, or deployment, will be compensated. Your precise pay level will be based on your rank, job (MOS), and educational level. The more money you make, the higher you rise.
To know more about national guard visit:
https://brainly.com/question/6070336
#SPJ4
Please answer this question with two sentences. Ill give brainliest to whoever answers correctly with 2 sentences!
A polygraph test is conducted, and the findings indicate that there is an 80 percent chance of deception. What does this mean for the investigation?
a) The suspect is guilty and should be arrested for the crime.
b) The suspect is probably just nervous since 80 percent is a pretty high number and usually indicates a false positive.
c) The suspect might be guilty, but more information is needed from other parts of the investigation.
D)There has been a mistake in the polygraph test, and the test should be conducted again to get better results.
Answer:
c
Explanation:
examination of bill of entry is done to vouch
Answer:
What? I Don't understand
Explanation:
How many judges are appointed?
The number of Supreme Court justices is determined by Congress and not by the Constitution. However, nine Justices, including one Chief Justice, have served in that capacity since 1869.
Who are the 13 judges?
The following names are mentioned in chronological order: Othniel, Ehud, Shamgar, Deborah/Barak, Gideon, Tola, Jair, Jephthah, Ibzan, Elon, Abdon, and Samson. The judicial roles of two further Judges, Eli and Samuel, are recorded in 1 Samuel.
How should I address the jurors in the best way?
Starting your letter with "Dear Judge" (or "Dear Justice" if the judge is from a U.S. state) allows you to address a number of judges.
The simplest method is to write the letter using the judge's full name.
To know more about judges visit:
https://brainly.com/question/1030749
#SPJ4
You want to work in the court, and you have just heard that most cases that come across a prosecutor’s desk never go to trial. What are your options? One of the prosecutor’s jobs is to work with law enforcement officials. Larger offices, as in New York, do tend to have larger cases with more opportunities. Drop the idea of becoming a prosecutor. Learn what other tasks prosecutors do in particular offices or agencies.
multiple choice
Common law originated from custom and use rather than from written statutes. While American law is based on custom, most jurisdictions have now codified their criminal law via statute and legislation.
What is canvassing in selling?
Canvassing is a technique in income where you try to promote to plausible clients who have little or no ride with the brand before you contact them. Businesses use canvassing to expand sales, enhance brand awareness and develop their patron base
Is Canvassing a marketing?Canvassing is a method of advertising used via businesses to generate appointments for the organization's sales force. Canvassers set up appointments with particular data regarding the pastimes of the precise customer.
The 4 Ps are product, price, place, and promotion. They are an instance of a “marketing mix,” or the combined tools and methodologies used through marketers to reap their advertising objectives. The 4 Ps had been first formally conceptualized in 1960 via E.
Learn more about Canvassing here:
https://brainly.com/question/29788263#SPJ4the citizens of ________ are most likely to participate as campaign volunteers during an election.
Answer: The United States
Explanation: This is because of the way that the political system is based in the United States where local support is very important due to the electoral system and the high number of districts. Volunteering to help a candidate can be really helpful in the United States, especially in swing states where you might get many voters to support a side.
Citizens of the United States have been found to participate more as campaign volunteers during an election, than citizens of other countries such as; Germany, France, Great Britain and the Netherlands.
Hope this was helpful
What are the methods of judicial activism?
Which of the following is considered a risk of driving?
A. Spending too much on gas
B. Getting lost
C. Causing damage
What happened in Vietnam after World War II ended?
Following World War II and the demise of Vietnam's monarchy, France sought to re-establish colonial power in the country but was defeated in the First Indo-China War. The Geneva Accords of 1954 divided the nation temporarily, with the promise of democratic elections in 1956 to reunite it.
What occurred during World War II?World War II, sometimes known as the Second World War, was a global conflict that lasted from 1939 to 1945. The vast majority of the world's countries, including all of the world's great powers, formed two competing military alliances: the Allies and the Axis powers. World Conflict II was a complete war in which more than 100 million people from more than 30 nations were actively involved.
To learn more about World War II, click
https://brainly.com/question/7589784
#SPJ1
Local legislation was passed to protect animal species prone to extinction. the legislation included criminalizing poaching, setting limits on number of fish people can catch, and protecting habitats. which of the following threats shown in the graph will most likely decrease the most as a result of the legislation?
As the legislation provisions included criminalizing poaching, setting limits on number of fish people can catch etc; the threats that will most likely decrease the most as a result of the legislation is Over-harvesting.
What does Over-harvesting mean?Also known as over-exploitation, is when a renewable resource is harvested to the point of diminishing returns. A continued overexploitation may result in the resource's demise because it will be unable to replenish.
Overexploitation is one of the five major activities threatening global biodiversity. Ecologists use the term to describe populations that are harvested at an unsustainable rate based on their natural rates of mortality and reproductive capacities.
Full Options "A Habitat loss and degradation B Pollution C Overharvesting D Climate and natural disasters
Read more about Over-harvesting
brainly.com/question/9192607
#SPJ1